OneTaqHot Start 2X Master Mix with Standard Buffer from New England Biolabs

Product Specs
ItemOneTaqHot Start 2X Master Mix with Standard Buffer
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberM0484S
Quantity100 reactions
ApplicationsDNA Analysis
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeMaster Mix
Temperature-20 C

Specifications/Features

Information:
Source: An E. coli strain that carries the Taq DNA Polymerase gene from Thermus aquaticus YT-1 and an E. coli strain that carries the Deep Vent_R DNA Polymerase gene from Pyrococcus species GB-D.

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) CRISPR/Cas9-based split homing gene drive targeting doublesex for population suppression of the global fruit pest Drosophila suzukiiProceedings of the National Academy of SciencesJune 20, 2023Amarish K. Yadav, Cole Butler, Akihiko Yamamoto, Anandrao A. Patil, Alun L. Lloyd, Maxwell J. Scott(Cat#69504) following the manufacturer’s instructions. The DNA was amplified using OneTaq polymerase (NEB#M0484S) and the primer pair DsxcutF1_GGGTAAGTGAACTGATCATTGAAAC and DsxcutR1_ GAAGATAATCCAAGTTGCGCTTTAG that

(2) Biallelic variants in OGDH encoding oxoglutarate dehydrogenase lead to a neurodevelopmental disorder characterized by global developmental delay, movement disorder, and metabolic abnormalitiesGenetics in medicine : official journal of the American College of Medical GeneticsFebruary 1, 2023Whittle EF, Chilian M, Karimiani EG, Progri H, Buhas D, Kose M, Ganetzky RD, Toosi MB, Torbati PN, Badv RS, et al.(5′-TGGTAGCTCCTGATGATGGCC-3′). All PCR reactions were executed using One Taq Hot Start 2X Master Mix with Standard Buffer (M0484S, NEB). The PCR product was purified using QIAquick PCR Purification Kit (28106, QIAGEN) or QIAquick

(3) CRISPR/Cas9-mediated tissue-specific knockout and cDNA rescue using sgRNAs that target exon-intron junctions in Drosophila melanogasterSTAR ProtocolsSeptember 16, 2022Madison Chilian, Karen Vargas Parra, Abigail Sandoval, Juan Ramirez, Wan Hee Yoon,New England Biolabs,Cat# R0144S OneTaq Hot Start 2× Master Mix with Standard Buffer,New England Biolabs,Cat# M0484S "BD Bacto Yeast Extract, Technical",VWR,Cat# 90004-092 BD Bacto Trypton,VWR,Cat# 90000-286 Sodium chloride

(4) Role of Neural (N)-Cadherin in Breast Cancer Cell Stemness and Dormancy in the Bone MicroenvironmentCancers (Basel)March 4, 2022Antonio Maurizi, Michela Ciocca, Cristiano Giuliani, Ilaria Di Carlo, Anna TetiSynthesis Kit (cat: K1622) was from ThermoFisher, Waltham, MA, USA. OneTaq® Hot Start 2X Master Mix (cat: M0484S) and Luna® Universal qPCR Master Mix (cat: M3003) were from New England BioLabs (Ipswich, MA, USA).

(5) Kinetics of receptor tyrosine kinase activation define ERK signaling dynamicsScience signalingAugust 18, 2020Kiyatkin A, van Alderwerelt van Rosenburgh IK, Klein DE, Lemmon MA.colonies were tested by PCR to identify insert-containing constructs using OneTaq DNA polymerase (NEB # M0484S) and a pair of vector and gene-specific primers. The correct plasmid was finally selected by Sanger sequencing

(6) Gene expression studies using a miniaturized thermal cycler system on board the International Space StationPLOS ONEOctober 31, 2018Tessa G. Montague, Alia Almansoori, Emily J. Gleason, D. Scott Copeland, Kevin Foley, Sebastian Kraves, Ezequiel Alvarez Saavedrainactivation. On Earth, 1 μL of the extracted DNA was placed in tubes with OneTaq Hot Start Taq kit (NEB, M0484S) and 0.4 μM of the set-25 primers for DNA amplification using the following protocol: 95˚C/2 min, [95˚C/30

(7) Dosage Compensation of X-Linked Muller Element F Genes but Not X-Linked Transgenes in the Australian Sheep BlowflyPLOS ONEOctober 27, 2015Rebecca J. Linger, Esther J. Belikoff, Maxwell J. Scott30x, 72°C 8 min). For some primer sets, PCR was performed using OneTaq Hot Start 2X Master Mix (Cat#M0484S New England Biolabs) (94°C 3 min, [94°C 15 sec, 55°C 30 sec, 68°C 1 min] 30x, 68°C 5 min). PCR products

Be the First to Write a Review!